Ghrelin (GHRL) is a hormone involved in energy metabolism regulation. It induces appetite promoting the use of carbohydrates; inhibits lipid oxidation; stimulates gastric acid secretion and motility. GHRL is also an antiinflammatory peptide localized in nonspecific immune organs such as the skin where it provides a protective role for innate immunity. This work aims to investigate the expression of the GHRL, as a molecule involved in energy metabolism, in the skin of the sheep fed differently to assess if the feeding can modulate the secretion of the molecule in the skin. Hence, GHRL was investigated by immunohistochemistry and Real time-PCR in the skin of 15 Comisana × Appenninica adult female sheep reared in a semi-natural pasture of the Italian Central Apennines. Samples were collected from the thoracic region at the maximum pasture flowering (MxF, 5 ewes) and at the maximum pasture dryness (MxD, 10 ewes). Five ewes of the second group were fed with 600 gr/die/head of barley and corn (1: 1) in addition to the fresh forage (Exp). Immunohistochemistry was performed on formalin-fixed and paraffin-embedded sections by using a polyclonal anti- GHRL antibody (Abcam Cambridge UK). The primer sequences used for the Real-time PCR were as follows: F: GGAACCTAAGAAGCCGTCAGG, R: ATTTCCAGCTCGTCCTCTGC, NCBI n. DQ152959.1 (Ovis aries). GHRL staining was mainly observed in a confined area of the anagen hair follicles at the level of the suprabulbar region. Positivity involved the inner layers of the outer root sheath and the inner root sheath. GHRL was also observed in the smooth muscle cells. A significant difference in GHRL expression (3.6-fold) was evidenced by Real-time PCR between M×F vs Exp group. No differences were evaluated between the other groups. Therefore, the dietary supplementation of animals seems to have a positive modulating effect for the skin GHRL transcript compared to animals fed in MxF. This is a preliminary report that introduces GHRL investigation in the sheep skin however, the influence of diet on this molecule needs further elucidation.
Ghrelin expression in the skin of the sheep changes in relation to diets
Francesca Mercati;Elisa Palmioli
;Cecilia Dall’Aglio;Daniele Marini;Polina Anipchenko;Margherita Maranesi
2022
Abstract
Ghrelin (GHRL) is a hormone involved in energy metabolism regulation. It induces appetite promoting the use of carbohydrates; inhibits lipid oxidation; stimulates gastric acid secretion and motility. GHRL is also an antiinflammatory peptide localized in nonspecific immune organs such as the skin where it provides a protective role for innate immunity. This work aims to investigate the expression of the GHRL, as a molecule involved in energy metabolism, in the skin of the sheep fed differently to assess if the feeding can modulate the secretion of the molecule in the skin. Hence, GHRL was investigated by immunohistochemistry and Real time-PCR in the skin of 15 Comisana × Appenninica adult female sheep reared in a semi-natural pasture of the Italian Central Apennines. Samples were collected from the thoracic region at the maximum pasture flowering (MxF, 5 ewes) and at the maximum pasture dryness (MxD, 10 ewes). Five ewes of the second group were fed with 600 gr/die/head of barley and corn (1: 1) in addition to the fresh forage (Exp). Immunohistochemistry was performed on formalin-fixed and paraffin-embedded sections by using a polyclonal anti- GHRL antibody (Abcam Cambridge UK). The primer sequences used for the Real-time PCR were as follows: F: GGAACCTAAGAAGCCGTCAGG, R: ATTTCCAGCTCGTCCTCTGC, NCBI n. DQ152959.1 (Ovis aries). GHRL staining was mainly observed in a confined area of the anagen hair follicles at the level of the suprabulbar region. Positivity involved the inner layers of the outer root sheath and the inner root sheath. GHRL was also observed in the smooth muscle cells. A significant difference in GHRL expression (3.6-fold) was evidenced by Real-time PCR between M×F vs Exp group. No differences were evaluated between the other groups. Therefore, the dietary supplementation of animals seems to have a positive modulating effect for the skin GHRL transcript compared to animals fed in MxF. This is a preliminary report that introduces GHRL investigation in the sheep skin however, the influence of diet on this molecule needs further elucidation.I documenti in IRIS sono protetti da copyright e tutti i diritti sono riservati, salvo diversa indicazione.


